Genetisch onderzoek

Retinitis Pigmentosa wordt veroorzaakt door een verandering in het DNA (een mutatie). Het DNA zit in bijna iedere cel van het lichaam en codeert voor allerlei eiwitten. In bovenstaand figuur zie je hoe dit in zijn werk gaat.

Opdracht 2

A. Zet de stappen in de juiste volgorde:

1. Na vouwing van de aminozuurketen: een eiwit
2. TTATCCGGGCTGATGGATGATCAT
3. Methionine-Isoleucine-Isoleucine-Histidine-Glutamine-Proline-Glycine
4. AUGAUCAUCCAUCAGCCCGGAUAA

Het mRNA wordt afgelezen in codons. Een codon bestaat uit 3 basen, bijvoorbeeld AUG. Een codon wordt ook wel een triplet genoemd.
B. Voor welk aminozuur codeert AUG? Gebruik hiervoor de codontabel.

Dokter van Steveninck weet te vertellen dat Retinitis Pigmentosa vaak wordt veroorzaakt door een mutatie in het gen van rhodopsine. Rhodopsine is een lichtgevoelig eiwit in de staafjes van het oog.
In een speciale databank op internet kan de basenvolgorde van rhodopsine worden opgezocht. Die ziet er zo uit:

>GezondRhodopsine
augaauggcacagaaggcccuaacuucuacgugcccuucuccaaugcgacggguguggua
cgcagccccuucgaguacccacaguacuaccuggcugagccauggcaguucuccaugcug
gccgccuacauguuucugcugaucgugcugggcuuccccaucaacuuccucacgcucuac
gucaccguccagcacaagaagcugcgcacgccucucaacuacauccugcucaaccuagcc
guggcugaccucuucaugguccuagguggcuucaccagcacccucuacaccucucugcau
ggauacuucgucuucgggcccacaggaugcaauuuggagggcuucuuugccacccugggc
ggugaaauugcccugugguccuuggugguccuggccaucgagcgguacgugguggugugu
aagcccaugagcaacuuccgcuucggggagaaccaugccaucaugggcguugccuucacc
ugggucauggcgcuggccugcgccgcacccccacucgccggcugguccagguacaucccc
gagggccugcagugcucguguggaaucgacuacuacacgcucaagccggaggucaacaac
gagucuuuugucaucuacauguucgugguccacuucaccauccccaugauuaucaucuuu
uucugcuaugggcagcucgucuucaccgucaaggaggccgcugcccagcagcaggaguca
gccaccacacagaaggcagagaaggaggucacccgcauggucaucaucauggucaucgcu
uuccugaucugcugggugcccuacgccagcguggcauucuacaucuucacccaccagggc
uccaacuucggucccaucuucaugaccaucccagcguucuuugccaagagcgccgccauc
uacaacccugucaucuauaucaugaugaacaagcaguuccggaacugcaugcucaccacc
aucugcugcggcaagaacccacugggugacgaugaggccucugcuaccguguccaagacg
gagacgagccagguggccccggccuaa

De volgorde bestaat uit 1047 basen.

Dokter van Steveninck wil het DNA van het ongeboren kindje van Mark en Marjolein vergelijken met gezond DNA. Met moderne apparatuur analyseert hij het DNA van het kindje. Hij zoekt specifiek naar het rhodopsine gen.
De basenvolgorde van rhodopsine van het kindje ziet er zo uit:

>Rhodopsinebaby
augaauggcacagaaggcccuaacuucuacgugcccuucuccaaugcgacggguguggua
cgcagccccuucgaguacccacaguacuaccuggcugagccauggcaguucuccaugcug
gccgccuacauguuucugcugaucgugcugggcuuccccaucaacuuccucacgcucuac
gucaccguccagcacaagaagcugcgcacgccucucaacuacauccugcucaaucuagcc
guggcugaccucuucaugguccuagguggcuucaccagcacccucuacaccucucugcau
ggauacuucgucuucgggcccacaggaugcaauuuggagggcuucuuugccacccugggc
ggugaaauugcccugugguccuuggugguccuggccaucgagcgguacgugguggugugu
aagcccaugagcaacuuccgcuucggggagaaccaugccaucaugggcguugccuucacc
ugggucauggcgcuggccugcgccgcacccccacucgccggcugguccagguacaucccc
gagggccugcagugcccguauggaaucgacuacuacacgcucaagccggaggucaacaac
gagucuuuugucaucuacagguucgugguccacuucaccauccccaugauuaucaucuuu
uucugcuaugggcagcucgucuucaccgucaaggaggccgcugcccagcagcaggaguca
gccaccacacagaaggcagagaaggaggucacccgcauggucaucaucauggucaucgcu
uuccugaucugcugggugcccuacgccagcguggcauucuacaucuucacccaccagggc
uccaacuucggucccaucuucaugaccaucccagaguucuuugccgagagcgccgccauc
uacaacccugucaucuauaucaugaugaacaagcaguuccggaacugcaugcucaccacc
aucugcugcggcaagaacccacugggugacgaugaggccucugcuacaguguccaagacg
gagacgagccagguggccccggccuaa

Ook deze volgorde bestaat uit 1047 basen.

Opdracht 3

A. Deze volgordes van basen coderen beiden voor het eiwit rhodopsine. Zijn dit DNA of een mRNA-volgordes? Waaraan kun je dat zien?

B. Waarvoor codeert het eerste codon? En het laatste? Gebruik hiervoor de codontabel.

Met het blote oog kun je niet makkelijk zien of er verschillen zijn tussen het normale rhodopsinegen en het rhodopsinegen van het kindje.

Klik hier om naar het volgende onderdeel te gaan