>GezondRhodopsine RNA
augaauggcacagaaggcccuaacuucuacgugcccuucuccaaugcgacggguguggua
cgcagccccuucgaguacccacaguacuaccuggcugagccauggcaguucuccaugcug
gccgccuacauguuucugcugaucgugcugggcuuccccaucaacuuccucacgcucuac
gucaccguccagcacaagaagcugcgcacgccucucaacuacauccugcucaaccuagcc
guggcugaccucuucaugguccuagguggcuucaccagcacccucuacaccucucugcau
ggauacuucgucuucgggcccacaggaugcaauuuggagggcuucuuugccacccugggc
ggugaaauugcccugugguccuuggugguccuggccaucgagcgguacgugguggugugu
aagcccaugagcaacuuccgcuucggggagaaccaugccaucaugggcguugccuucacc
ugggucauggcgcuggccugcgccgcacccccacucgccggcugguccagguacaucccc
gagggccugcagugcucguguggaaucgacuacuacacgcucaagccggaggucaacaac
gagucuuuugucaucuacauguucgugguccacuucaccauccccaugauuaucaucuuu
uucugcuaugggcagcucgucuucaccgucaaggaggccgcugcccagcagcaggaguca
gccaccacacagaaggcagagaaggaggucacccgcauggucaucaucauggucaucgcu
uuccugaucugcugggugcccuacgccagcguggcauucuacaucuucacccaccagggc
uccaacuucggucccaucuucaugaccaucccagcguucuuugccaagagcgccgccauc
uacaacccugucaucuauaucaugaugaacaagcaguuccggaacugcaugcucaccacc
aucugcugcggcaagaacccacugggugacgaugaggccucugcuaccguguccaagacg
gagacgagccagguggccccggccuaa

>Rhodopsinebaby RNA
augaauggcacagaaggcccuaacuucuacgugcccuucuccaaugcgacggguguggua
cgcagccccuucgaguacccacaguacuaccuggcugagccauggcaguucuccaugcug
gccgccuacauguuucugcugaucgugcugggcuuccccaucaacuuccucacgcucuac
gucaccguccagcacaagaagcugcgcacgccucucaacuacauccugcucaaucuagcc
guggcugaccucuucaugguccuagguggcuucaccagcacccucuacaccucucugcau
ggauacuucgucuucgggcccacaggaugcaauuuggagggcuucuuugccacccugggc
ggugaaauugcccugugguccuuggugguccuggccaucgagcgguacgugguggugugu
aagcccaugagcaacuuccgcuucggggagaaccaugccaucaugggcguugccuucacc
ugggucauggcgcuggccugcgccgcacccccacucgccggcugguccagguacaucccc
gagggccugcagugcccguauggaaucgacuacuacacgcucaagccggaggucaacaac
gagucuuuugucaucuacagguucgugguccacuucaccauccccaugauuaucaucuuu
uucugcuaugggcagcucgucuucaccgucaaggaggccgcugcccagcagcaggaguca
gccaccacacagaaggcagagaaggaggucacccgcauggucaucaucauggucaucgcu
uuccugaucugcugggugcccuacgccagcguggcauucuacaucuucacccaccagggc
uccaacuucggucccaucuucaugaccaucccagaguucuuugccgagagcgccgccauc
uacaacccugucaucuauaucaugaugaacaagcaguuccggaacugcaugcucaccacc
aucugcugcggcaagaacccacugggugacgaugaggccucugcuacaguguccaagacg
gagacgagccagguggccccggccuaa